riok3

Ensembl ID:
ENSDARG00000042751
ZFIN ID:
ZDB-GENE-040801-133
Description:
serine/threonine-protein kinase RIO3 [Source:RefSeq peptide;Acc:NP_001003614]
Human Orthologue:
RIOK3
Human Description:
RIO kinase 3 (yeast) [Source:HGNC Symbol;Acc:11451]
Mouse Orthologue:
Riok3
Mouse Description:
RIO kinase 3 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914128]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3260 Essential Splice Site F2 line generated During 2017
sa44177 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3260
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062745 Essential Splice Site 51 507 2 13
Genomic Location (Zv9):
Chromosome 24 (position 37739162)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36354078
KASP Assay ID:
554-2850.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCYCGGCAGCTGGACGAGGAGGGCAGTGCTTTATCACAGTGCCCAGAG[T/C]GAGTCTCAATCCTCCATATCAAACTATTACAGGCTTGAGGGCCGTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062745 Nonsense 79 507 3 13
Genomic Location (Zv9):
Chromosome 24 (position 37741408)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36356324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCAGACACGGACAGCGACCTGATTCTGGCCCAGATGCTTCAGATG[C/T]AGTTCGACCGCGAGTTTGATACACAGCTGCGCATAGAGGAGAAGAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link