fzd6

Ensembl ID:
ENSDARG00000042731
ZFIN ID:
ZDB-GENE-040426-1451
Description:
frizzled-6 [Source:RefSeq peptide;Acc:NP_956855]
Human Orthologue:
FZD6
Human Description:
frizzled homolog 6 (Drosophila) [Source:HGNC Symbol;Acc:4044]
Mouse Orthologue:
Fzd6
Mouse Description:
frizzled homolog 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108474]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22966 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062703 Nonsense 165 419 2 2
Genomic Location:
Chromosome 16 (position 58080199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTGCGCAACGCTCTTCACCTTCCTCACGTTCCTGATGGACGCGCAG[C/T]GATTCCGCTACCCTGAGCGGCCCATCGTCTTCATCTCCGTCTGCTACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3f4spco8