kdm4b

Ensembl ID:
ENSDARG00000042729
ZFIN ID:
ZDB-GENE-060503-664
Description:
lysine-specific demethylase 4B [Source:RefSeq peptide;Acc:NP_001076274]
Human Orthologue:
KDM4B
Human Description:
lysine (K)-specific demethylase 4B [Source:HGNC Symbol;Acc:29136]
Mouse Orthologue:
Kdm4b
Mouse Description:
lysine (K)-specific demethylase 4B Gene [Source:MGI Symbol;Acc:MGI:2442355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15777 Essential Splice Site Available for shipment Available now
sa17996 Nonsense Available for shipment Available now
sa10758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034084 Essential Splice Site 306 1134 5 21
ENSDART00000128161 Essential Splice Site 306 1134 6 22
Genomic Location:
Chromosome 22 (position 3922489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCCATTCCTCCCGAGCACGGCAAGAGGCTGGARAGGCTGGCGCAAGG[T/C]AAGACCTCACATCCGTTTGTTATCGTGTCTTCAAGCTRAAAYGAAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034084 Nonsense 579 1134 10 21
ENSDART00000128161 Nonsense 579 1134 11 22
Genomic Location:
Chromosome 22 (position 3946158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCCAGGAAGTGTTTGAGCAGWTCACCACCGCCAGCGAAATGCAGAAC[C/T]AGAGCAATGGAGCTGCCCCTCTGCAGGTGAGGAGACTCNTTYCTATCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034084 Nonsense 665 1134 12 21
ENSDART00000128161 Nonsense 665 1134 13 22
Genomic Location:
Chromosome 22 (position 3951102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACAGCGACCTGTGGCAGAACCGTTCKCCGAACTTCCTAGCCGAGAAA[C/T]AGTTCAACGCGGCCATGTCCACCATTGAGCCGTACTGCGCCATCTGCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/378dodu9