si:ch211-253b1.3

Ensembl ID:
ENSDARG00000042726
ZFIN ID:
ZDB-GENE-091118-23
Human Orthologue:
GRB7
Human Description:
growth factor receptor-bound protein 7 [Source:HGNC Symbol;Acc:4567]
Mouse Orthologue:
Grb7
Mouse Description:
growth factor receptor bound protein 7 Gene [Source:MGI Symbol;Acc:MGI:102683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24541 Splice Site, Nonsense Available for shipment Available now
sa37945 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062699 Splice Site, Nonsense 222 531 5 14
Genomic Location (Zv9):
Chromosome 24 (position 37922827)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36537743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGACAGCGCTGATGTCACTAAAGGCATGACATCATCAGAGCTGGTC[C/T]AGGTAGGAGGATCCAGAGCTTTTAAAGGGGTCTTTTTTGTTTATTTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062699 Essential Splice Site 483 531 13 14
Genomic Location (Zv9):
Chromosome 24 (position 37936912)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36551828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCACTGTGGCATGAACTCAAGACAAAACACTACCTCATCATTCCT[G/T]TAAGTCTTTATTCCTCACTGTGAATCAGCTTCTTTTTAATCAAGAATTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link