cebpb

Ensembl ID:
ENSDARG00000042725
ZFIN ID:
ZDB-GENE-020111-3
Description:
CCAAT/enhancer-binding protein beta [Source:RefSeq peptide;Acc:NP_571959]
Human Orthologue:
CEBPB
Human Description:
CCAAT/enhancer binding protein (C/EBP), beta [Source:HGNC Symbol;Acc:1834]
Mouse Orthologue:
Cebpb
Mouse Description:
CCAAT/enhancer binding protein (C/EBP), beta Gene [Source:MGI Symbol;Acc:MGI:88373]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34427 Nonsense Mutation detected in F1 DNA During 2016
sa14362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062702 Nonsense 179 280 1 1
Genomic Location (Zv9):
Chromosome 8 (position 29302149)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28415031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCGAGCGGCAGCCTGGGGAACATTTCGACCGCGTCTTCCTCCTGCT[C/A]GAGCCCGCCAGGTACACCTGCGCCGTCAGGTAAGGGAAGATCACCTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062702 Nonsense 257 280 1 1
Genomic Location (Zv9):
Chromosome 8 (position 29301916)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28414798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGACGCAGCACAAAGTGCTCGAGCTCGCGGYCGAGAACGACCGGTTA[C/T]AGAAGCGCGTGGAGCAGCTGTCACGAGAACTGGCGACGCTGCGGAACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link