cebpb

Ensembl ID:
ENSDARG00000042725
ZFIN ID:
ZDB-GENE-020111-3
Description:
CCAAT/enhancer-binding protein beta [Source:RefSeq peptide;Acc:NP_571959]
Human Orthologue:
CEBPB
Human Description:
CCAAT/enhancer binding protein (C/EBP), beta [Source:HGNC Symbol;Acc:1834]
Mouse Orthologue:
Cebpb
Mouse Description:
CCAAT/enhancer binding protein (C/EBP), beta Gene [Source:MGI Symbol;Acc:MGI:88373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062702 Nonsense 257 280 1 1
Genomic Location:
Chromosome 8 (position 29301916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGACGCAGCACAAAGTGCTCGAGCTCGCGGYCGAGAACGACCGGTTA[C/T]AGAAGCGCGTGGAGCAGCTGTCACGAGAACTGGCGACGCTGCGGAACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ad5hqewn