gfra2

Ensembl ID:
ENSDARG00000042723
ZFIN ID:
ZDB-GENE-040630-1
Description:
Glial cell line derived neurotrophic factor family receptor alpha 2 [Source:UniProtKB/TrEMBL;Acc:B0S
Human Orthologues:
AC144571.1, GFRA2
Human Description:
GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
Mouse Orthologue:
Gfra2
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5773 Nonsense Mutation detected in F1 DNA During 2014
sa10192 Nonsense Available for shipment Available now
sa6102 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062697 Nonsense 137 495 3 9
Genomic Location:
Chromosome 8 (position 44223575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATGTATCTTAATAGTTTGTATTGTTTCTTTTTAGGTGAAGACTTTTA[T/A]GAGCCATCTCCTTATGAACCCATGACGCCTCACCGACATTCAGATGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062697 Nonsense 158 495 3 9
Genomic Location:
Chromosome 8 (position 44223513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAACCCATGACGCCTCACCGACATTCAGATGCATTTCGCCTGGCGT[C/A]AATCATCTCAGGTAAAGCAGCATTTTCAATACAGTTTATTTGTATTNNGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062697 Nonsense 191 495 4 9
Genomic Location:
Chromosome 8 (position 44179549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGACCCGAGCCGCCCTTGCAACCCCTGWCTGGATGCTACCAAAGCCTG[C/A]AACCTGAATGAAAACTGCAAGCGTCAGCGCTCCAACTACATCTCCACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nhl9ry5u