gfra2

Ensembl ID:
ENSDARG00000042723
ZFIN ID:
ZDB-GENE-040630-1
Description:
Glial cell line derived neurotrophic factor family receptor alpha 2 [Source:UniProtKB/TrEMBL;Acc:B0S
Human Orthologues:
AC144571.1, GFRA2
Human Description:
GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
Mouse Orthologue:
Gfra2
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10192 Nonsense Available for shipment Available now
sa6102 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062697 Nonsense 158 495 3 9
Genomic Location (Zv9):
Chromosome 8 (position 44223513)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42176295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAACCCATGACGCCTCACCGACATTCAGATGCATTTCGCCTGGCGT[C/A]AATCATCTCAGGTAAAGCAGCATTTTCAATACAGTTTATTTGTATTNNGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062697 Nonsense 191 495 4 9
Genomic Location (Zv9):
Chromosome 8 (position 44179549)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42132331
KASP Assay ID:
554-3785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGACCCGAGCCGCCCTTGCAACCCCTGWCTGGATGCTACCAAAGCCTG[C/A]AACCTGAATGAAAACTGCAAGCGTCAGCGCTCCAACTACATCTCCACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link