blnk

Ensembl ID:
ENSDARG00000042722
ZFIN ID:
ZDB-GENE-040702-4
Description:
B-cell linker protein [Source:RefSeq peptide;Acc:NP_998003]
Human Orthologue:
BLNK
Human Description:
B-cell linker [Source:HGNC Symbol;Acc:14211]
Mouse Orthologue:
Blnk
Mouse Description:
B-cell linker Gene [Source:MGI Symbol;Acc:MGI:96878]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14297 Nonsense Available for shipment Available now
sa9203 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Nonsense 126 490 6 23
ENSDART00000132281 None None 57 None 3
Genomic Location:
Chromosome 13 (position 51520416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCCACAATRTGAAGCCCTTCACTGTGTGTCCGTCCATCACAAACCCC[A/T]GAGGAGAATATGTGGGTGAGTCGCACTCAAACTACACTCARCTCTGTGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Essential Splice Site 226 490 11 23
ENSDART00000132281 None None 57 None 3
Genomic Location:
Chromosome 13 (position 51514478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATACATGTTTGTGTTCAATTTCAGGWGARTTCTGAATCTAAGAAAAG[G/A]TAAAACCMCTTCAARATAAGCCAYCTTTTTTGTATTTTATTTATATTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gzqqywsd