blnk

Ensembl ID:
ENSDARG00000042722
ZFIN ID:
ZDB-GENE-040702-4
Description:
B-cell linker protein [Source:RefSeq peptide;Acc:NP_998003]
Human Orthologue:
BLNK
Human Description:
B-cell linker [Source:HGNC Symbol;Acc:14211]
Mouse Orthologue:
Blnk
Mouse Description:
B-cell linker Gene [Source:MGI Symbol;Acc:MGI:96878]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14297 Nonsense Available for shipment Available now
sa42310 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9203 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Nonsense 126 490 6 23
ENSDART00000132281   None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51520416)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50230078
KASP Assay ID:
2260-7033.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCCACAATRTGAAGCCCTTCACTGTGTGTCCGTCCATCACAAACCCC[A/T]GAGGAGAATATGTGGGTGAGTCGCACTCAAACTACACTCARCTCTGTGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Essential Splice Site 218 490 10 23
ENSDART00000132281   None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51515590)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50225252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCTCTAATTCTGCTTTTCAGATTTCTATGAGATTCCTGACATGAAG[G/A]TGAGCTTTAATCAACACTAATGTACTTATCCATTGCAAAATAAAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Essential Splice Site 226 490 11 23
ENSDART00000132281   None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51514478)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50224140
KASP Assay ID:
2260-7031.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATACATGTTTGTGTTCAATTTCAGGWGARTTCTGAATCTAAGAAAAG[G/A]TAAAACCMCTTCAARATAAGCCAYCTTTTTTGTATTTTATTTATATTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link