adipor1b

Ensembl ID:
ENSDARG00000042717
ZFIN ID:
ZDB-GENE-040426-2896
Description:
adiponectin receptor protein 1 [Source:RefSeq peptide;Acc:NP_998665]
Human Orthologue:
ADIPOR1
Human Description:
adiponectin receptor 1 [Source:HGNC Symbol;Acc:24040]
Mouse Orthologue:
Adipor1
Mouse Description:
adiponectin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1919924]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12228 Essential Splice Site Available for shipment Available now
sa18920 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16380 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 145 377 4 8
Genomic Location:
Chromosome 8 (position 29235482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTCAGGATTCATACTGAAACTGGAAACATCTGGACACACCTGCTGG[G/A]TCTGTGCTTGAGAAATATTACATTTYGACTTGATACTAACATYGTCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 208 377 5 8
Genomic Location:
Chromosome 8 (position 29234549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACACAGTCTACTGCCATTCGGAGAAGGTTTCCAGAACTTTTTCCAA[G/T]TAAGTGATGATAGTTTGCTTGCATACGATGGATAGGATTGATTTAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 208 377 5 8
Genomic Location:
Chromosome 8 (position 29234548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACAYAGTCTACTGCCATTCGGAGAAGSTTTCCAGAACTTTYTCCAAG[T/G]AAGTGATGATAGTTTGCTTGCATAMSATGGATAGGATTGATTTAAAGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w5dbt1kn