tuba8l

Ensembl ID:
ENSDARG00000042708
ZFIN ID:
ZDB-GENE-030131-9167
Description:
tubulin, alpha 8 like [Source:RefSeq peptide;Acc:NP_997937]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21314 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062671 Nonsense 24 449 2 5
Genomic Location:
Chromosome 8 (position 29200801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGTGGGACAGGCCGGAGTACAAATTGGCAATGCATGCTGGGAATTGTA[T/A]TGCCTGGAGCATGGCATCCAGCCTGATGGCAACATGCCAAGTGATAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5subkjdh