ccdc76

Ensembl ID:
ENSDARG00000042701
ZFIN ID:
ZDB-GENE-050327-19
Description:
tRNA guanosine-2'-O-methyltransferase TRM13 homolog [Source:RefSeq peptide;Acc:NP_001014331]
Human Orthologue:
CCDC76
Human Description:
coiled-coil domain containing 76 [Source:HGNC Symbol;Acc:25502]
Mouse Orthologue:
Ccdc76
Mouse Description:
coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24126 Nonsense Available for shipment Available now
sa1529 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa24126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062649 Nonsense 71 458 3 11
Genomic Location:
Chromosome 22 (position 16530801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTACTGTTTGTGTTTTGAACAGCACTGTATTTGAAGATAATTTGACT[A/T]AACACCTGAAGAAATGTAACTCCAAGGAGAAACCAAAACCTGTATGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1529
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062649 Essential Splice Site 220 458 8 11
Genomic Location:
Chromosome 22 (position 16527057)
KASP Assay ID:
554-1453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAATATTGCTCTTCCTGMTCCAAGTTGAAGTTTYATTTCTTATTAA[G/T]GTAGACGGAAAGCACAAAAATGCAGACTCCACTTTTGACCGGCTTCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zh7hidnq