s1pr1

Ensembl ID:
ENSDARG00000042690
ZFIN ID:
ZDB-GENE-001228-2
Description:
Sphingosine 1-phosphate receptor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9DDK4]
Human Orthologue:
S1PR1
Human Description:
sphingosine-1-phosphate receptor 1 [Source:HGNC Symbol;Acc:3165]
Mouse Orthologue:
S1pr1
Mouse Description:
sphingosine-1-phosphate receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1096355]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29749 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062633 Essential Splice Site None 362 1 2
Genomic Location (Zv9):
Chromosome 22 (position 16188264)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16015834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTACTGCAGGATTACGCGGGCAGGACACTCAGTCTGGAGTTTGAAG[G/A]TAAGAGAAACTCTTCTTGTCCACTTTTTACTTTATGAATGTCAGGAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link