cadm1b

Ensembl ID:
ENSDARG00000042677
ZFIN ID:
ZDB-GENE-080327-34
Description:
cell adhesion molecule 1b [Source:RefSeq peptide;Acc:NP_001107024]
Human Orthologue:
CADM1
Human Description:
cell adhesion molecule 1 [Source:HGNC Symbol;Acc:5951]
Mouse Orthologue:
Cadm1
Mouse Description:
cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1889272]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062603 Nonsense 94 370 2 8
Genomic Location:
Chromosome 15 (position 17778876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCCGCTACGYGTGTCAACTCTACACGGATCCACCGCAAGAAGCCTA[C/A]GCCGACATCACTGTACTGGGTATGATTATCGATTCACCTCATTGATTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hfc79rdx