NP_956910.2

Ensembl ID:
ENSDARG00000042671
Description:
protein odr-4 homolog [Source:RefSeq peptide;Acc:NP_956910]
Human Orthologue:
C1orf27
Human Description:
chromosome 1 open reading frame 27 [Source:HGNC Symbol;Acc:24299]
Mouse Orthologue:
BC003331
Mouse Description:
cDNA sequence BC003331 Gene [Source:MGI Symbol;Acc:MGI:2385108]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6833 Nonsense Mutation detected in F1 DNA During 2017
sa19728 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062591 Nonsense 126 451 4 13
Genomic Location (Zv9):
Chromosome 2 (position 20667671)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21213609
KASP Assay ID:
554-5376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTAGCTTWTATTTGCCATGGATAAGTACATAACTAAGGGAAGACTGTG[G/A]GACCTGTCAGAGGAGGAYGTGACTGAGCGAGTCACCCTGCACATCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062591 Essential Splice Site 147 451 4 13
Genomic Location (Zv9):
Chromosome 2 (position 20667734)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21213672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACGTGACTGAGCGAGTCACCCTGCACATCTGCTCCAAAACGAAGAA[G/A]TATCCTTCATATGGCCTTCAATAATATTTCTCCTGTGAACTAAAAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link