klf2a

Ensembl ID:
ENSDARG00000042667
ZFIN ID:
ZDB-GENE-011109-1
Description:
Kruppel-like factor 2a [Source:RefSeq peptide;Acc:NP_571931]
Human Orthologue:
KLF2
Human Description:
Kruppel-like factor 2 (lung) [Source:HGNC Symbol;Acc:6347]
Mouse Orthologue:
Klf2
Mouse Description:
Kruppel-like factor 2 (lung) Gene [Source:MGI Symbol;Acc:MGI:1342772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30728 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24120 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062587 Essential Splice Site 322 380 2 3
Genomic Location (Zv9):
Chromosome 22 (position 16046081)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15873651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTACACAAAAAGTTCTCACTTGAAGGCTCATCACAGAACACACACAG[G/T]TAAATAAACGCCACTTGTTTTGTGTTTTCGTAAGATCTATCATAATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062587 Nonsense 350 380 3 3
Genomic Location (Zv9):
Chromosome 22 (position 16046266)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15873836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGGGTGGAAGTTCGCCCGTTCTGATGAATTGACCCGTCACTTCCGC[A/T]AGCACACCGGACACCGACCCTTCCAGTGCCACCTGTGCGAACGTGCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link