fam32al

Ensembl ID:
ENSDARG00000042660
ZFIN ID:
ZDB-GENE-040704-44
Description:
Protein FAM32A-like [Source:UniProtKB/Swiss-Prot;Acc:Q6GQN4]
Human Orthologue:
FAM32A
Human Description:
family with sequence similarity 32, member A [Source:HGNC Symbol;Acc:24563]
Mouse Orthologues:
Fam32a, Gm5590
Mouse Descriptions:
family with sequence similarity 32, member A Gene [Source:MGI Symbol;Acc:MGI:1915172]
predicted gene 5590 Pseudogene [Source:MGI Symbol;Acc:MGI:3645451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12319 Nonsense Available for shipment Available now
sa11913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128149 Nonsense 51 109 2 4
ENSDART00000128149 Nonsense 51 109 2 4
Genomic Location:
Chromosome 22 (position 15867117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAACAAGTTTTGACCWCTGAAAACGAAGAAGGAACTAAAAAAGCTTA[T/A]GTTGACAAAAGGACACCAGCACAGATGGCATTCGACAAAATACAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128149 Nonsense 51 109 2 4
ENSDART00000128149 Nonsense 51 109 2 4
Genomic Location:
Chromosome 22 (position 15867117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAACAAGTTTTGACCWCTGAAAACGAAGAAGGAACTAAAAAAGCTTA[T/A]GTTGACAAAAGGACACCAGCACAGATGGCATTCGACAAAATACAAGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2skbtiod