fam32al

Ensembl ID:
ENSDARG00000042660
ZFIN ID:
ZDB-GENE-040704-44
Description:
Protein FAM32A-like [Source:UniProtKB/Swiss-Prot;Acc:Q6GQN4]
Human Orthologue:
FAM32A
Human Description:
family with sequence similarity 32, member A [Source:HGNC Symbol;Acc:24563]
Mouse Orthologues:
Fam32a, Gm5590
Mouse Descriptions:
family with sequence similarity 32, member A Gene [Source:MGI Symbol;Acc:MGI:1915172]
predicted gene 5590 Pseudogene [Source:MGI Symbol;Acc:MGI:3645451]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12319 Nonsense Available for shipment Available now
sa11913 Nonsense Available for shipment Available now
sa37473 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128149 Nonsense 51 109 2 4
ENSDART00000128149 Nonsense 51 109 2 4
Genomic Location:
Chromosome 22 (position 15867117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAACAAGTTTTGACCWCTGAAAACGAAGAAGGAACTAAAAAAGCTTA[T/A]GTTGACAAAAGGACACCAGCACAGATGGCATTCGACAAAATACAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128149 Nonsense 51 109 2 4
ENSDART00000128149 Nonsense 51 109 2 4
Genomic Location:
Chromosome 22 (position 15867117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAACAAGTTTTGACCWCTGAAAACGAAGAAGGAACTAAAAAAGCTTA[T/A]GTTGACAAAAGGACACCAGCACAGATGGCATTCGACAAAATACAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128149 Essential Splice Site 87 109 3 4
Genomic Location:
Chromosome 22 (position 15867421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAGAATCTTGAAGAAAGCCTCCAAAACACACAAGAGAAGAGTTGAGG[T/C]AAGCATCAGTATTGAGATTCATGTAAGTAACAAGTGGTTATTTGGTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link