si:ch211-279l9.6

Ensembl ID:
ENSDARG00000042652
ZFIN ID:
ZDB-GENE-070912-273
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UXW3]
Human Orthologue:
RREB1
Human Description:
ras responsive element binding protein 1 [Source:HGNC Symbol;Acc:10449]
Mouse Orthologue:
Rreb1
Mouse Description:
ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38323 Nonsense Mutation detected in F1 DNA During 2017
sa31273 Nonsense Available for shipment Available now
sa19729 Nonsense Available for shipment Available now
sa19730 Nonsense Available for shipment Available now
sa16673 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062563 Nonsense 155 1672 4 11
Genomic Location (Zv9):
Chromosome 2 (position 20844928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21390866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCTTTCTGCAGCACAACACGGACAGTGGTGGCACTGACCACTCGTG[C/A]AGTATTTGCGGAAAGGCTTTGAGTTCGGCCAGCTCTCTGGACCGACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062563 Nonsense 318 1672 7 11
Genomic Location (Zv9):
Chromosome 2 (position 20849218)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21395156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCGCAAACACCGTGGTCTCCTGCGTCATAATGCTGCCATTCATAAA[C/T]AGCTTCCAACTGACCCCTCTGGGCGACCTTTTATACAGAACAACCCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062563 Nonsense 387 1672 8 11
Genomic Location (Zv9):
Chromosome 2 (position 20849509)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21395447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCCATAAGTTTGTTTGTGAGGACTGCAACAAGGCCTTCCCTATTCAG[C/T]AATCTCTGGATCTTCACAAGTCTTCACATAACTGTAGTGTAGACACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062563 Nonsense 585 1672 8 11
Genomic Location (Zv9):
Chromosome 2 (position 20850103)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21396041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTCTGGGTAGTCCTCTTCAAGTGGACCCCAGACAGATTTCTTCTTTA[A/T]AACCCAAGTCCTTAATCACTCCCCGATCCAGCATGGGTGCCTCCACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062563 Nonsense 875 1672 8 11
Genomic Location (Zv9):
Chromosome 2 (position 20850973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21396911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTCACCATTTGCYGAAACACCACCCAGATGTGCCAGAAAGGGAAATT[G/T]AGGAGCACATCAAAAGTCTTGTACCAGTTGGANNNGAAGTCAATGCTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link