tert

Ensembl ID:
ENSDARG00000042637
ZFIN IDs:
ZDB-GENE-080405-1, ZDB-GENE-080405-1
Description:
telomerase reverse transcriptase [Source:RefSeq peptide;Acc:NP_001077335]
Human Orthologue:
TERT
Human Description:
telomerase reverse transcriptase [Source:HGNC Symbol;Acc:11730]
Mouse Orthologue:
Tert
Mouse Description:
telomerase reverse transcriptase Gene [Source:MGI Symbol;Acc:MGI:1202709]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3430 Nonsense Available for shipment Available now
sa25076 Nonsense Mutation detected in F1 DNA During 2014
sa6541 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu3430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 156 1088 3 19
ENSDART00000098893 Nonsense 164 1098 2 16
Genomic Location:
Chromosome 19 (position 608257)
KASP Assay ID:
554-0052.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTACCTGCTGCAGGACTGTGCCGTTTTCACCACCGTCCCGCCATCGTG[T/A]GTTCTGCAGGTGTGCGGAGAACCTGTTTACGACTTGCTGATGCCGCGCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 231 1088 3 19
ENSDART00000098893 Nonsense 239 1098 2 16
Genomic Location:
Chromosome 19 (position 608480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTCGGTAAAGCGGCGGAGGGTAAAGGAAACTGTGAATAATAATAAC[G/T]GAAATTACAGATCTCGGTGTTTTGCAATTTCTAAAAAGAGAGCGAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 440 1088 3 19
ENSDART00000098893 Nonsense 448 1098 2 16
Genomic Location:
Chromosome 19 (position 609109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAGGATATGGAGTCTCTGCTGAAGTCACACTCGTCTCCWTATAGAGTTTA[T/A]CTGTTYGTCAGGGAGTGTCTGCGCYATATTATTCCCCACGAGCTCTGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)
  • Breast cancer: A common variant at the TERT-CLPTM1L locus is associated with estrogen receptor-negative breast cancer. (View Study)
  • Glioma: Chromosome 7p11.2 (EGFR) variation influences glioma risk. (View Study)
  • Glioma: Combinations of newly confirmed Glioma-Associated loci link regions on chromosomes 1 and 9 to increased disease risk. (View Study)
  • Glioma: Genome-wide association study identifies five susceptibility loci for glioma. (View Study)
  • Glioma: Genome-wide association study of glioma and meta-analysis. (View Study)
  • Idiopathic pulmonary fibrosis: A genome-wide association study identifies an association of a common variant in TERT with susceptibility to idiopathic pulmonary fibrosis. (View Study)
  • Lung adenocarcinoma: A genome-wide association study identifies two new susceptibility loci for lung adenocarcinoma in the Japanese population. (View Study)
  • Lung adenocarcinoma: A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma. (View Study)
  • Lung adenocarcinoma: The 5p15.33 locus is associated with risk of lung adenocarcinoma in never-smoking females in Asia. (View Study)
  • Lung adenocarcinoma: Variation in TP63 is associated with lung adenocarcinoma susceptibility in Japanese and Korean populations. (View Study)
  • Lung cancer: A genome-wide association study identifies two new lung cancer susceptibility loci at 13q12.12 and 22q12.2 in Han Chinese. (View Study)
  • Lung cancer: Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. (View Study)
  • Lung cancer: Lung cancer susceptibility locus at 5p15.33. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
  • Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)
  • Prostate-specific antigen levels: Genetic correction of PSA values using sequence variants associated with PSA levels. (View Study)
  • Testicular germ cell cancer: Variants near DMRT1, TERT and ATF7IP are associated with testicular germ cell cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8hzpqbsx