glrx2

Ensembl ID:
ENSDARG00000042631
ZFIN ID:
ZDB-GENE-040718-101
Description:
glutaredoxin-2, mitochondrial [Source:RefSeq peptide;Acc:NP_001002404]
Human Orthologue:
GLRX2
Human Description:
glutaredoxin 2 [Source:HGNC Symbol;Acc:16065]
Mouse Orthologue:
Glrx2
Mouse Description:
glutaredoxin 2 (thioltransferase) Gene [Source:MGI Symbol;Acc:MGI:1916617]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37514 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062537 Essential Splice Site 21 134 2 4
ENSDART00000124368 Essential Splice Site 39 152 2 4
ENSDART00000131990 Essential Splice Site 57 170 2 4
ENSDART00000141762 Essential Splice Site 49 162 2 4
Genomic Location (Zv9):
Chromosome 22 (position 23684132)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24188880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCATCTGCGCCTGGGTTGTCAAGCTCAGCTTGTGGTCAGTTTGTGCAG[G/A]TAAGCTTTACCAGCCGAAAATTAACCATGGTTTTAATGAGGTAATATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link