nhsl1b

Ensembl ID:
ENSDARG00000042627
ZFIN ID:
ZDB-GENE-040910-1
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SPA0]
Human Orthologue:
NHSL1
Human Description:
NHS-like 1 [Source:HGNC Symbol;Acc:21021]
Mouse Orthologue:
Nhsl1
Mouse Description:
NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43469 Nonsense Mutation detected in F1 DNA During 2017
sa43470 Nonsense Mutation detected in F1 DNA During 2017
sa32298 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062532 Nonsense 591 1571 6 8
ENSDART00000145066 Nonsense 475 1455 4 6
Genomic Location (Zv9):
Chromosome 20 (position 30903919)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30975132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGAAGGACAATGACTTCCAGCTGCTCAACACCCATAAATCATCTATA[T/G]AGTAGCCTTGAACGCTCCTCAAAAGGCACAGACTCTAGTTCACTGTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062532 Nonsense 1012 1571 6 8
ENSDART00000145066 Nonsense 896 1455 4 6
Genomic Location (Zv9):
Chromosome 20 (position 30905181)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30976394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACAATTCCTCCCCTGAATTTCCACCCCCTCCACCTCCAGAAGTGT[T/A]GACCGACCCTGCCTGTTCAGGCTTTAATAGTTCCTTCAGCCCTCCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062532 Nonsense 1255 1571 6 8
ENSDART00000145066 Nonsense 1139 1455 4 6
Genomic Location (Zv9):
Chromosome 20 (position 30905909)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30977122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCTGGACCCCATACCTGTGCTGGAAAAAGAGGAAGAGACAACTGAG[A/T]AAAGTAGCTTTGACATTTCCGTACCTCCTGTAGAGATAAGAGACATTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link