acbd3

Ensembl ID:
ENSDARG00000042623
ZFIN ID:
ZDB-GENE-040426-1930
Description:
acyl-Coenzyme A binding domain containing 3 [Source:RefSeq peptide;Acc:NP_998162]
Human Orthologue:
ACBD3
Human Description:
acyl-CoA binding domain containing 3 [Source:HGNC Symbol;Acc:15453]
Mouse Orthologue:
Acbd3
Mouse Description:
acyl-Coenzyme A binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2181074]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37067 Nonsense Mutation detected in F1 DNA During 2016
sa23733 Nonsense Available for shipment Available now
sa4909 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 55 523 1 8
ENSDART00000062528 Nonsense 55 210 1 5
ENSDART00000127058 Nonsense 55 210 1 5
ENSDART00000130714 Nonsense 46 513 1 11
Genomic Location:
Chromosome 20 (position 30728648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGACGCCCGATGGCCAGTCGGCGGAGCAGAGCCACGAAAACCCTGAG[C/T]AGAGTGTCGATGGGGAGGAGGGCGAACCTACCAGCAGCGCTAATATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 119 523 2 8
ENSDART00000062528 Nonsense 119 210 2 5
ENSDART00000127058 Nonsense 119 210 2 5
ENSDART00000130714 Nonsense 110 513 2 11
Genomic Location:
Chromosome 20 (position 30730827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAACTCCGTCTGGTAGCCCTCCACAAACAGGTGTTACAGGGCCCTTA[C/A]AACCCAGATGCTTCCCCTGAAGTGGGCTTCTTCGATGTGTTGGGAAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525   None 523 None 8
ENSDART00000062528   None 210 None 5
ENSDART00000127058   None 210 None 5
ENSDART00000130714 Essential Splice Site 199 513 5 11
Genomic Location:
Chromosome 20 (position 30736573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTYTTGAGATGCATGTTTTAGAATAATTYACCAGAGCAGCAAAAAG[T/G]TATTGGCCTTTAATTAAACAACTTTTTAATCCTGAACTTGTCTTGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link