acbd3

Ensembl ID:
ENSDARG00000042623
ZFIN ID:
ZDB-GENE-040426-1930
Description:
acyl-Coenzyme A binding domain containing 3 [Source:RefSeq peptide;Acc:NP_998162]
Human Orthologue:
ACBD3
Human Description:
acyl-CoA binding domain containing 3 [Source:HGNC Symbol;Acc:15453]
Mouse Orthologue:
Acbd3
Mouse Description:
acyl-Coenzyme A binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2181074]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23733 Nonsense Mutation detected in F1 DNA During 2014
sa4909 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 119 523 2 8
ENSDART00000062528 Nonsense 119 210 2 5
ENSDART00000127058 Nonsense 119 210 2 5
ENSDART00000130714 Nonsense 110 513 2 11
Genomic Location:
Chromosome 20 (position 30730827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAACTCCGTCTGGTAGCCCTCCACAAACAGGTGTTACAGGGCCCTTA[C/A]AACCCAGATGCTTCCCCTGAAGTGGGCTTCTTCGATGTGTTGGGAAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 None None 523 None 8
ENSDART00000062528 None None 210 None 5
ENSDART00000127058 None None 210 None 5
ENSDART00000130714 Essential Splice Site 199 513 5 11
Genomic Location:
Chromosome 20 (position 30736573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTYTTGAGATGCATGTTTTAGAATAATTYACCAGAGCAGCAAAAAG[T/G]TATTGGCCTTTAATTAAACAACTTTTTAATCCTGAACTTGTCTTGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ck7zgqt