acbd3

Ensembl ID:
ENSDARG00000042623
ZFIN ID:
ZDB-GENE-040426-1930
Description:
acyl-Coenzyme A binding domain containing 3 [Source:RefSeq peptide;Acc:NP_998162]
Human Orthologue:
ACBD3
Human Description:
acyl-CoA binding domain containing 3 [Source:HGNC Symbol;Acc:15453]
Mouse Orthologue:
Acbd3
Mouse Description:
acyl-Coenzyme A binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2181074]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37067 Nonsense Mutation detected in F1 DNA During 2016
sa23733 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 55 523 1 8
ENSDART00000062528 Nonsense 55 210 1 5
ENSDART00000127058 Nonsense 55 210 1 5
ENSDART00000130714 Nonsense 46 513 1 11
Genomic Location (Zv9):
Chromosome 20 (position 30728648)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30799861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGACGCCCGATGGCCAGTCGGCGGAGCAGAGCCACGAAAACCCTGAG[C/T]AGAGTGTCGATGGGGAGGAGGGCGAACCTACCAGCAGCGCTAATATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 119 523 2 8
ENSDART00000062528 Nonsense 119 210 2 5
ENSDART00000127058 Nonsense 119 210 2 5
ENSDART00000130714 Nonsense 110 513 2 11
Genomic Location (Zv9):
Chromosome 20 (position 30730827)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30802040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAACTCCGTCTGGTAGCCCTCCACAAACAGGTGTTACAGGGCCCTTA[C/A]AACCCAGATGCTTCCCCTGAAGTGGGCTTCTTCGATGTGTTGGGAAACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link