sema3h

Ensembl ID:
ENSDARG00000042616
ZFIN ID:
ZDB-GENE-990715-8
Description:
semaphorin 3h [Source:RefSeq peptide;Acc:NP_571125]
Human Orthologues:
SEMA3A, SEMA3C, SEMA3D, SEMA3E, SEMA3F, SEMA3G
Human Descriptions:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G [Source:HGNC
Mouse Orthologues:
Sema3a, Sema3b, Sema3c, Sema3d, Sema3e, Sema3f, Sema3g
Mouse Descriptions:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G Gene [Source:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41220 Nonsense Mutation detected in F1 DNA During 2017
sa2459 Nonsense F2 line generated During 2017
sa21304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 207 749 6 17
Genomic Location (Zv9):
Chromosome 8 (position 26782966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25910884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTGCGTTTATTCGAAGTCTGGGGGAGCGACATGTGATTCGCACCGAA[C/T]AATACGACTCTACGTGGCTGCAAGGTGACACATGTGTAAATGTACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2459
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 262 749 7 17
Genomic Location (Zv9):
Chromosome 8 (position 26783297)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25911215
KASP Assay ID:
554-3332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAGGGGCTGCTGGGAAGGTCCTGTATTCCAGAGTGGCCCGCGTCTG[T/A]AAGGTATCTAGCAGTGTKCTCCTACGTGCCCGACTGCACTTGTGTGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 388 749 11 17
Genomic Location (Zv9):
Chromosome 8 (position 26795421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25923339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTGTCCCAGCAGCACATACGGAGGCTTCAGATCCACAAGGGAATA[T/A]CCAGATGACGTGATCTTCTTCAGCCGCACACATCCGCTGATGCAGGAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link