rbm19

Ensembl ID:
ENSDARG00000042590
ZFIN ID:
ZDB-GENE-031125-3
Description:
probable RNA-binding protein 19 [Source:RefSeq peptide;Acc:NP_944597]
Human Orthologue:
RBM19
Human Description:
RNA binding motif protein 19 [Source:HGNC Symbol;Acc:29098]
Mouse Orthologue:
Rbm19
Mouse Description:
RNA binding motif protein 19 Gene [Source:MGI Symbol;Acc:MGI:1921361]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20801 Nonsense Available for shipment Available now
sa2331 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Nonsense 357 927 10 25
ENSDART00000130336 Nonsense 357 927 10 24
ENSDART00000131073 Nonsense 250 275 11 12
Genomic Location:
Chromosome 6 (position 45798052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAGTTCCCGTTTGTTCATTATCTGTGTGAACCCACAGGAGGGCGCTA[C/A]ATTGAGGTTTTCAGAGCCAACAACTTTAAAAACGACAGGCGTTCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Nonsense 873 927 23 25
ENSDART00000130336 Nonsense 873 927 23 24
ENSDART00000131073 None None 275 None 12
Genomic Location:
Chromosome 6 (position 45785159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGTGACAGAAAGCGTTCTCAGCACTRTGCCACAGCACTCATCTGTA[C/A]GGCAGRAGGCTGGTGCTGGAGTGGGCAGATGCTGAGGAGACGGTAGACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zguk5p0g