rbm19

Ensembl ID:
ENSDARG00000042590
ZFIN ID:
ZDB-GENE-031125-3
Description:
probable RNA-binding protein 19 [Source:RefSeq peptide;Acc:NP_944597]
Human Orthologue:
RBM19
Human Description:
RNA binding motif protein 19 [Source:HGNC Symbol;Acc:29098]
Mouse Orthologue:
Rbm19
Mouse Description:
RNA binding motif protein 19 Gene [Source:MGI Symbol;Acc:MGI:1921361]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26817 Nonsense Mutation detected in F1 DNA During 2016
sa20801 Nonsense Available for shipment Available now
sa33947 Essential Splice Site Available for shipment Available now
sa40776 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Nonsense 205 927 5 25
ENSDART00000130336 Nonsense 205 927 5 24
ENSDART00000131073 Nonsense 98 275 6 12
Genomic Location (Zv9):
Chromosome 6 (position 45803626)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45864560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGAATCAAGTGATGACGGCGAGGATGCTGCAGATGAAGAGGACAAA[C/T]AAGGTGCAATATTTAATTTAACAAATTTTAGCACTGATTACGATGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Nonsense 357 927 10 25
ENSDART00000130336 Nonsense 357 927 10 24
ENSDART00000131073 Nonsense 250 275 11 12
Genomic Location (Zv9):
Chromosome 6 (position 45798052)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45858986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAGTTCCCGTTTGTTCATTATCTGTGTGAACCCACAGGAGGGCGCTA[C/A]ATTGAGGTTTTCAGAGCCAACAACTTTAAAAACGACAGGCGTTCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Essential Splice Site 720 927 17 25
ENSDART00000130336 Essential Splice Site 720 927 17 24
ENSDART00000131073   None 275 None 12
Genomic Location (Zv9):
Chromosome 6 (position 45791671)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45852605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATTAAGAACTTGAACTTTATCACCTCAGAAGAAACATTACAGAAGG[T/C]AAACTAAAAACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062459 Nonsense 796 927 21 25
ENSDART00000130336 Nonsense 796 927 21 24
ENSDART00000131073   None 275 None 12
Genomic Location (Zv9):
Chromosome 6 (position 45788200)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45849134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTTATGTTGTTTTTGTAGGTCAGGTGTGGCACAGGCCAAGAGGAAA[A/T]AGCAAACCGCCAGGAAACAGACGACCTCTAAGATCTTGGTGCGAAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link