LOC100002026

Ensembl ID:
ENSDARG00000042586
Human Orthologue:
PCDH8
Human Description:
protocadherin 8 [Source:HGNC Symbol;Acc:8660]
Mouse Orthologue:
Pcdh8
Mouse Description:
protocadherin 8 Gene [Source:MGI Symbol;Acc:MGI:1306800]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3710 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062464 Nonsense 170 970 1 3
Genomic Location:
Chromosome 9 (position 55719924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCGCGCTGGACGCCGCYGAAGATTCAGACGTGGGTTCAAACTCCATC[C/T]AAAGCTACGAGCTRAGCGAGAACTCGCACTTCAGCATCGATGTCATCACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/juc4v8vm