NP_001123547.1

Ensembl ID:
ENSDARG00000042580
Description:
hypothetical protein LOC100000126 [Source:RefSeq peptide;Acc:NP_001123547]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23606 Nonsense Available for shipment Available now
sa12012 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062454 Nonsense 70 306 2 5
Genomic Location (Zv9):
Chromosome 19 (position 49916238)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48752814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCCATCAGCTCGAAGAGAAGCCCCTGGTGGAGAGTTTCTCTAGCA[C/T]AGACCTACAGAATCGCCAAAATCTCCATCAGCACCGGCACTGAGGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062454 Nonsense 252 306 4 5
Genomic Location (Zv9):
Chromosome 19 (position 49914249)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48754803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGTCARCGGCGCGAGGGTGACCATCGGGGACTCRCTGCAGGAYGAGGGA[C/T]GAGCAAACCCGCTGTAGGAGACACACCAYACTAGCCTGACATCTGAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link