rnaseh1

Ensembl ID:
ENSDARG00000042571
ZFIN ID:
ZDB-GENE-040718-407
Description:
ribonuclease H1 [Source:RefSeq peptide;Acc:NP_001002659]
Human Orthologue:
RNASEH1
Human Description:
ribonuclease H1 [Source:HGNC Symbol;Acc:18466]
Mouse Orthologue:
Rnaseh1
Mouse Description:
ribonuclease H1 Gene [Source:MGI Symbol;Acc:MGI:1335073]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9127 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062441 None None 276 1 8
ENSDART00000148242 Essential Splice Site None 160 None 5
Genomic Location:
Chromosome 20 (position 30404798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAACGCAAGAAGAAGCAGTCGTTTGTCAGCTGACCGCTAGCTTAGAGG[T/C]AGGAGGTGCACACATGTTTCAGAAACTCATATCMACTAAATCCATTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062441 Nonsense 20 276 1 8
ENSDART00000148242 Nonsense 20 160 2 5
Genomic Location:
Chromosome 20 (position 30405063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGAAACTTTTTCTACGCTGTGARRAAAGGATTTAAACCCGGAGWGTA[T/G]CARACATGGTGAGCCTTAAGCTGTGTAGCYATATGCTCTATTTACTAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n5argrgz