map3k12

Ensembl ID:
ENSDARG00000042565
ZFIN ID:
ZDB-GENE-040426-2436
Description:
mitogen-activated protein kinase kinase kinase 12 [Source:RefSeq peptide;Acc:NP_996977]
Human Orthologue:
MAP3K12
Human Description:
mitogen-activated protein kinase kinase kinase 12 [Source:HGNC Symbol;Acc:6851]
Mouse Orthologue:
Map3k12
Mouse Description:
mitogen-activated protein kinase kinase kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1346881]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38717 Nonsense Mutation detected in F1 DNA During 2016
sa34533 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 217 856 4 15
Genomic Location (Zv9):
Chromosome 9 (position 257176)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 227334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGTGTGTGTACACAGGCTCCGTGTTACTGCATCCTCATGGAGTACTG[T/A]GCGCAGGGTCAGCTGTATGAGGTGCTGCGTGCGGGCCGGAAGATCACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 300 856 5 15
Genomic Location (Zv9):
Chromosome 9 (position 256019)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 228491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCAGGGATAAAAGCACCAAGATGTCGTTCGCTGGCACCGTGGCCTG[G/A]ATGGCACCGGAGGTGATACGGAACGAACCTGTGTCTGAGAAAGTGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link