map3k12

Ensembl ID:
ENSDARG00000042565
ZFIN ID:
ZDB-GENE-040426-2436
Description:
mitogen-activated protein kinase kinase kinase 12 [Source:RefSeq peptide;Acc:NP_996977]
Human Orthologue:
MAP3K12
Human Description:
mitogen-activated protein kinase kinase kinase 12 [Source:HGNC Symbol;Acc:6851]
Mouse Orthologue:
Map3k12
Mouse Description:
mitogen-activated protein kinase kinase kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1346881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8327 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 211 856 4 15
Genomic Location:
Chromosome 9 (position 257194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTNNNNNNNNNNTTCAGGGGTGTGTGTACACAGGCTCCGTGTTAYTG[C/A]ATCCTCATGGAGTACTGTGCGCAGGGTCAGYTGTATGAGGTGCTGCGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gcenwaca