map3k12

Ensembl ID:
ENSDARG00000042565
ZFIN ID:
ZDB-GENE-040426-2436
Description:
mitogen-activated protein kinase kinase kinase 12 [Source:RefSeq peptide;Acc:NP_996977]
Human Orthologue:
MAP3K12
Human Description:
mitogen-activated protein kinase kinase kinase 12 [Source:HGNC Symbol;Acc:6851]
Mouse Orthologue:
Map3k12
Mouse Description:
mitogen-activated protein kinase kinase kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1346881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8327 Nonsense Mutation detected in F1 DNA During 2016
sa38717 Nonsense Mutation detected in F1 DNA During 2016
sa34533 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 211 856 4 15
Genomic Location:
Chromosome 9 (position 257194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTGTNNNNNNNNNNTTCAGGGGTGTGTGTACACAGGCTCCGTGTTAYTG[C/A]ATCCTCATGGAGTACTGTGCGCAGGGTCAGYTGTATGAGGTGCTGCGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 217 856 4 15
Genomic Location:
Chromosome 9 (position 257176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGTGTGTGTACACAGGCTCCGTGTTACTGCATCCTCATGGAGTACTG[T/A]GCGCAGGGTCAGCTGTATGAGGTGCTGCGTGCGGGCCGGAAGATCACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 300 856 5 15
Genomic Location:
Chromosome 9 (position 256019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCAGGGATAAAAGCACCAAGATGTCGTTCGCTGGCACCGTGGCCTG[G/A]ATGGCACCGGAGGTGATACGGAACGAACCTGTGTCTGAGAAAGTGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link