si:busm1-142b24.1

Ensembl ID:
ENSDARG00000042563
ZFIN IDs:
ZDB-GENE-030616-151, ZDB-GENE-030616-151
Description:
kinetochore-associated protein KNL-2 homolog [Source:RefSeq peptide;Acc:NP_001006662]
Human Orthologue:
C14orf106
Human Description:
chromosome 14 open reading frame 106 [Source:HGNC Symbol;Acc:20190]
Mouse Orthologue:
C79407
Mouse Description:
expressed sequence C79407 Gene [Source:MGI Symbol;Acc:MGI:2145099]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42951 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12149 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062430 Essential Splice Site 502 1011 8 13
ENSDART00000113300 Essential Splice Site 531 857 9 11
Genomic Location (Zv9):
Chromosome 17 (position 28678863)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28602790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAACGTTACTGTCCATGAAGACTATTCAACCTCAGTACCATCCACGG[T/C]ACTCTTATTTGATTCAGCATTTCAAACTGTGTGTCTTTATCTATCGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062430 Nonsense 967 1011 12 13
ENSDART00000113300   None 857 None 11
Genomic Location (Zv9):
Chromosome 17 (position 28680728)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28604655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGATGACCATGATGACGTGTTTACCAGCTCGCCCATGCACAGTAAA[C/T]AAATCAAGGTGCTTTTGTRTGGACTGAGTTTGAGCACAACTTTAGACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link