rnf144ab

Ensembl ID:
ENSDARG00000042557
ZFIN ID:
ZDB-GENE-040718-486
Description:
Probable E3 ubiquitin-protein ligase RNF144A-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DH94]
Human Orthologue:
RNF144A
Human Description:
ring finger protein 144A [Source:HGNC Symbol;Acc:20457]
Mouse Orthologue:
Rnf144a
Mouse Description:
ring finger protein 144A Gene [Source:MGI Symbol;Acc:MGI:1344401]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37062 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062421 Nonsense 65 293 3 8
ENSDART00000132278 Nonsense 65 294 3 8
Genomic Location (Zv9):
Chromosome 20 (position 29871769)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29942982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATATGTTGAACTGCTCATTAAAGAGGGCCTCGAAACGGCTATTAGCTG[T/A]CCAGATTCTACCTGCCCAAAACAAGGACATTTGCTGGAGAATGAGGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link