nr5a2

Ensembl ID:
ENSDARG00000042556
ZFIN ID:
ZDB-GENE-990415-79
Description:
nuclear receptor subfamily 5 group A member 2 [Source:RefSeq peptide;Acc:NP_571538]
Human Orthologue:
NR5A2
Human Description:
nuclear receptor subfamily 5, group A, member 2 [Source:HGNC Symbol;Acc:7984]
Mouse Orthologue:
Nr5a2
Mouse Description:
nuclear receptor subfamily 5, group A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1346834]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37513 Nonsense Mutation detected in F1 DNA During 2017
sa37512 Nonsense Mutation detected in F1 DNA During 2017
sa43841 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062417 Nonsense 58 516 2 11
ENSDART00000127424 Nonsense 58 517 2 7
Genomic Location (Zv9):
Chromosome 22 (position 23084519)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22691970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGAGATGTGTCCAGTGTGCGGAGACAAGGTGTCCGGATATCACTA[T/A]GGGTTGCTGACCTGTGAGAGCTGTAAGGTGTGTAACATCAGCTGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062417 Nonsense 89 516 3 11
ENSDART00000127424 Nonsense 89 517 3 7
Genomic Location (Zv9):
Chromosome 22 (position 23082722)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22690187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGGTGCAGAACAACAAGCGCTACACATGTATAGAGAACCAGAGCTGT[C/T]AAATAGACAAGACCCAGCGGAAACGTTGCCCCTACTGTCGCTTCCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062417 Essential Splice Site 385 516 8 11
ENSDART00000127424 Essential Splice Site 386 517 5 7
Genomic Location (Zv9):
Chromosome 22 (position 23038687)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22645299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGATGCACGCCAAAGAAGGCTCCATCCTCCTGGTCACGGGGCAACAGG[T/C]GAGTGTCTCCTCCATCTCCTCCCTACAGAGCTCATCAGGCCTTTTTGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link