si:ch211-167h3.1

Ensembl ID:
ENSDARG00000042555
ZFIN ID:
ZDB-GENE-091204-348
Human Orthologue:
DYM
Human Description:
dymeclin [Source:HGNC Symbol;Acc:21317]
Mouse Orthologue:
Dym
Mouse Description:
dymeclin Gene [Source:MGI Symbol;Acc:MGI:1918480]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23843 Nonsense Available for shipment Available now
sa10263 Nonsense Available for shipment Available now
sa11233 Essential Splice Site Available for shipment Available now
sa11707 Essential Splice Site Available for shipment Available now
sa23842 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062418 Nonsense 96 623 3 15
ENSDART00000139194 Nonsense 96 525 4 14
Genomic Location (Zv9):
Chromosome 21 (position 3851809)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3449065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGTTTTTCTCAGCAGAACCAAAGAGCTGAAGATTTCCACAGAATGC[C/T]AAGAGTAAGTCAGAAACCTCTACATTGAGGTGTGCTTATTTCTATGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062418 Nonsense 424 623 11 15
ENSDART00000139194 Nonsense 426 525 12 14
Genomic Location (Zv9):
Chromosome 21 (position 3784826)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3382082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGATTCCTATGTATTATTAATTCTCTCTCAGCTGTTGAARAACATCT[C/A]GTGGTACACCGAACGTGTCCTAACAGAGATCTCCCTAGGAAGTCTGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062418 Essential Splice Site 456 623 11 15
ENSDART00000139194 Essential Splice Site 458 525 12 14
Genomic Location (Zv9):
Chromosome 21 (position 3784728)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3381984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCCTGGTCGTCATCCGAACCATCCAATTYAACATGACCCGCACAAGG[G/A]YGAGTCCAGAACCACAGWGAYAAATACAGTTTGAAACATCCACAACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062418 Essential Splice Site 456 623 11 15
ENSDART00000139194 Essential Splice Site 458 525 12 14
Genomic Location (Zv9):
Chromosome 21 (position 3784727)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3381983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCTGGTCGTCATCCGAACCATCCAATTYAACATGACCCGCACAAGGR[T/C]GAGTCCAGAACCACAGWGAYAAATACAGTTTGAAACATCCACAACTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062418 Essential Splice Site 523 623 None 15
ENSDART00000139194   525 525 14 14
Genomic Location (Zv9):
Chromosome 21 (position 3760355)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3357611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACGAGGGCCTCTTGGAGACGAGGACAGGACCGTCCTGCCAGACTATG[T/C]AAGTCCATCCTTCAGTTGTATGAAAGCGTTTTGGCTTTCCTGTAAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Genome-wide association study of body height in African Americans: the Women's Health Initiative SNP Health Association Resource (SHARe). (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link