pex7

Ensembl ID:
ENSDARG00000042553
ZFIN ID:
ZDB-GENE-050320-105
Description:
peroxisomal biogenesis factor 7 [Source:RefSeq peptide;Acc:NP_001013550]
Human Orthologue:
PEX7
Human Description:
peroxisomal biogenesis factor 7 [Source:HGNC Symbol;Acc:8860]
Mouse Orthologue:
Pex7
Mouse Description:
peroxisomal biogenesis factor 7 Gene [Source:MGI Symbol;Acc:MGI:1321392]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062414 Nonsense 264 314 9 10
ENSDART00000135895   None 167 None 5
Genomic Location (Zv9):
Chromosome 20 (position 39563235)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39635004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTAGCATGATTGCCTTCTGCTGCTCTGCGTCCACAGATTCTGGGATTA[T/G]TCCAAGAGCCAGGCGCTGCTGGAGACGCTGGAGCACCACTCGGAGTTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link