cacna1sb

Ensembl ID:
ENSDARG00000042552
ZFIN ID:
ZDB-GENE-051227-1
Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit, b [Source:RefSeq peptide;Acc:NP_99989
Human Orthologue:
CACNA1S
Human Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit [Source:HGNC Symbol;Acc:1397]
Mouse Orthologue:
Cacna1s
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit Gene [Source:MGI Symbol;Acc:MGI:88294]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12580 Essential Splice Site Available for shipment Available now
sa27213 Nonsense Mutation detected in F1 DNA During 2015
sa1443 Essential Splice Site F2 line generated During 2015

Mutation Details

Allele Name:
sa12580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062406 Essential Splice Site 74 1847 1 45
Genomic Location:
Chromosome 8 (position 26620969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGAAACCCTTTCCGGAAGGCTTGCACCAACATTGTGGAATGGAAG[T/A]ATCCTTCGCAATTACGCTTGTTCTGGTTTTTCCAGCAGCTTCGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062406 Nonsense 142 1847 3 45
Genomic Location:
Chromosome 8 (position 26626742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAAAGATAATAGCATACGGCCTCTTGTTCCATGAAGGAGCCTATTTA[C/T]GAAATTGTTGGAATATATTGGACTTTGTCATTGTGTTCATGGGGTAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1443
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062406 Essential Splice Site 870 1847 19 45
Genomic Location:
Chromosome 8 (position 26640031)
KASP Assay ID:
554-1369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAGACATCGTCTTCACAACGGTCTTCACCATTGAGATTGTGCTGAAG[G/A]TAATGCACTTGTCAGCTTTATTTAACCTTCAGATTTGTGATTTGGCTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u818hgqc