cacna1sb

Ensembl ID:
ENSDARG00000042552
ZFIN ID:
ZDB-GENE-051227-1
Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit, b [Source:RefSeq peptide;Acc:NP_99989
Human Orthologue:
CACNA1S
Human Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit [Source:HGNC Symbol;Acc:1397]
Mouse Orthologue:
Cacna1s
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit Gene [Source:MGI Symbol;Acc:MGI:88294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12580 Essential Splice Site Available for shipment Available now
sa1443 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa12580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062406 Essential Splice Site 74 1847 1 45
Genomic Location:
Chromosome 8 (position 26620969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGAAACCCTTTCCGGAAGGCTTGCACCAACATTGTGGAATGGAAG[T/A]ATCCTTCGCAATTACGCTTGTTCTGGTTTTTCCAGCAGCTTCGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1443
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062406 Essential Splice Site 870 1847 19 45
Genomic Location:
Chromosome 8 (position 26640031)
KASP Assay ID:
554-1369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAGACATCGTCTTCACAACGGTCTTCACCATTGAGATTGTGCTGAAG[G/A]TAATGCACTTGTCAGCTTTATTTAACCTTCAGATTTGTGATTTGGCTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u818hgqc