mboat2b

Ensembl ID:
ENSDARG00000042551
ZFIN IDs:
ZDB-GENE-041001-185, ZDB-GENE-060512-236
Description:
hypothetical protein LOC692278 [Source:RefSeq peptide;Acc:NP_001038716]
Human Orthologue:
MBOAT2
Human Description:
membrane bound O-acyltransferase domain containing 2 [Source:HGNC Symbol;Acc:25193]
Mouse Orthologue:
Mboat2
Mouse Description:
membrane bound O-acyltransferase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13923 Essential Splice Site, Missense Available for shipment Available now
sa23729 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062405 Essential Splice Site 127 169 6 8
ENSDART00000142669 Missense 351 395 10 11

The following transcripts of ENSDARG00000042551 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 29763684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACGCTGTCCTTACAATCCCACTGCTGCCACCTTCCTGCTGTCAGCCA[T/A]GTGGCATGGGGCTTATCCAGGCTACTACCTCACCTTCCTCACGGGCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062405 Nonsense 165 169 7 8
ENSDART00000142669 Nonsense 391 395 11 11

The following transcripts of ENSDARG00000042551 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 29767663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTAGGTGAGGCACAATGTAAGACCACATTTCTTGGGTTCCCCAAGT[C/A]ACAAATTTGTGTATGACGTCATCACATGGGCAGCTACACAGATCGCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2aiidsbk