sema3ga

Ensembl ID:
ENSDARG00000042545
ZFIN ID:
ZDB-GENE-050513-3
Description:
semaphorin 3ga [Source:RefSeq peptide;Acc:NP_001014823]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31657 Essential Splice Site Available for shipment Available now
sa21302 Nonsense Available for shipment Available now
sa38690 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18643 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701   None 749 1 17
ENSDART00000143938 Essential Splice Site None 749 2 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26543837)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25671755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGTCTACCTTGTTTTATTTTTCTTTCTTTTGTGTGGGTTTTTACA[G/A]GTTGCCTGCGAATGGCTGGAACTATGAGAGTTATGGAAACGCGACTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Nonsense 59 749 2 17
ENSDART00000143938 Nonsense 59 749 3 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26518666)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25646584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCGGACAGCGAGGCCGTTCAGTTTTTCCTTCAACACCAGTGACTA[T/A]CGGATTCTGCATGTTGATCCAGACCAAGGCCGGTTGTACCTGGGCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 115 749 4 17
ENSDART00000143938 Essential Splice Site 115 749 5 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26517885)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25645803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCAGTTCAACAGTGGTTTGTTTGTTTGTGTGCATGTGTGTGTTTTTC[A/T]GGGAGAGTGTGCTAACTTTGTGCGCTTGATTGAGCCGTGGAACAGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 459 749 12 17
ENSDART00000143938 Essential Splice Site 459 749 13 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26510239)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25638157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACWAATGCWGTGTAGATTTCAACTGTTTGTCTTTTCTGCCACCCTAC[A/T]GATCGTGGGACAGTCCAGAAAGTTATAGTTCTACCTAAGGATCCCAYAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link