ywhaqa

Ensembl ID:
ENSDARG00000042539
ZFIN ID:
ZDB-GENE-040122-5
Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide a [Source
Human Orthologue:
YWHAQ
Human Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide [Source:HG
Mouse Orthologue:
Ywhaq
Mouse Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide Gene [Sour

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1704 Nonsense Available for shipment Available now
sa10800 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062383 Nonsense 4 245 2 6
Genomic Location:
Chromosome 20 (position 29592656)
KASP Assay ID:
554-1650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCCCGGAGTTTAAACGACCGCATCGTGCGCTTAAATCATGGATAAGT[T/A]GGAGCTGATTCAGAAAGCCAAGCTGGCGGAGCAGGCGGAGCGCTACGATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062383 Nonsense 179 245 4 6
Genomic Location:
Chromosome 20 (position 29606035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACCCTATTCGTCTGGGACTGGCTCTCAACTTCTCTGTCTTCTACTA[T/A]GAGATCCTTAACTCTCCGGAACAGGCTTGTTCTCWGGCAAAACAGGTAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wf3oyqmn