hm:zewp0073

Ensembl ID:
ENSDARG00000042535
ZFIN IDs:
ZDB-GENE-030131-172, ZDB-GENE-040520-4
Description:
actin, alpha, cardiac muscle 1a [Source:RefSeq peptide;Acc:NP_001001409]
Human Orthologue:
ACTC1
Human Description:
actin, alpha, cardiac muscle 1 [Source:HGNC Symbol;Acc:143]
Mouse Orthologue:
Actc1
Mouse Description:
actin, alpha, cardiac muscle 1 Gene [Source:MGI Symbol;Acc:MGI:87905]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29379 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062370 Essential Splice Site 86 377 3 9
Genomic Location (Zv9):
Chromosome 20 (position 29506995)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 47992506
GRCz10 20 29578208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACCCCATCGAGCACGGCATCATCACCAACTGGGATGACATGGAGAAG[G/A]TACCGATGAAACATCCGTTAATCAAACATGGGAGGCATTCAGTCCAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link