nup205

Ensembl ID:
ENSDARG00000042530
ZFIN ID:
ZDB-GENE-040715-8
Description:
nuclear pore complex protein Nup205 [Source:RefSeq peptide;Acc:NP_001003859]
Human Orthologue:
NUP205
Human Description:
nucleoporin 205kDa [Source:HGNC Symbol;Acc:18658]
Mouse Orthologue:
Nup205
Mouse Description:
nucleoporin 205 Gene [Source:MGI Symbol;Acc:MGI:2141625]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43060 Nonsense Mutation detected in F1 DNA During 2017
sa25054 Nonsense Mutation detected in F1 DNA During 2017
sa14979 Essential Splice Site Available for shipment Available now
sa6504 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43059 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43058 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6122 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Nonsense 305 1972 7 41
ENSDART00000062360 Nonsense 305 1996 7 40
ENSDART00000125555 Nonsense 310 2001 7 40
ENSDART00000143923 Nonsense 310 1977 7 41
Genomic Location (Zv9):
Chromosome 18 (position 11710045)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12292774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTATCGATTAGACCTGCTCCAGGCTTTGCCTCTGTTGACGGAGAAA[C/T]AGTACGTGGCAGCCGTGCACAGTCGGCTGGTTGAGGGTCAAGGCTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Nonsense 1007 1972 20 41
ENSDART00000062360 Nonsense 1005 1996 20 40
ENSDART00000125555 Nonsense 1010 2001 20 40
ENSDART00000143923 Nonsense 1012 1977 20 41
Genomic Location (Zv9):
Chromosome 18 (position 11699247)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12281976
KASP Assay ID:
554-7808.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTTTTGATCACGTCCCTGGAGCTAACAGGCCCCAATCTGGGCCTGTA[T/A]CTGCTTGGCTATGAAGTCAAGAAGCCAGTTTCCTCCACTAACCTTCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Essential Splice Site 1181 1972 25 41
ENSDART00000062360 Essential Splice Site 1178 1996 25 40
ENSDART00000125555 Essential Splice Site 1183 2001 25 40
ENSDART00000143923 Essential Splice Site 1186 1977 25 41
Genomic Location (Zv9):
Chromosome 18 (position 11695528)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12278257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTGAAATAATGGTGTTCCTTTAATCATGGTGATCTCTGGTGGTTTT[A/G]GTGCGCAGGAGGCTGCTCAGTGTTTTGGATGCCATAGATTTYAGTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Essential Splice Site 1625 1972 32 41
ENSDART00000062360 Essential Splice Site 1622 1996 32 40
ENSDART00000125555 Essential Splice Site 1627 2001 32 40
ENSDART00000143923 Essential Splice Site 1630 1977 32 41
Genomic Location (Zv9):
Chromosome 18 (position 11691087)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12273816
KASP Assay ID:
554-4578.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCATCTTGACCTCCACCACCGCACAGCACCAGCAGGGGGCAGCACAGG[T/C]ACTAAAACAATGATTCCAATGATGTCCCTAAAGCTCGTGCACACCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Essential Splice Site 1692 1972 34 41
ENSDART00000062360 Essential Splice Site 1689 1996 34 40
ENSDART00000125555 Essential Splice Site 1694 2001 34 40
ENSDART00000143923 Essential Splice Site 1697 1977 34 41
Genomic Location (Zv9):
Chromosome 18 (position 11689025)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12271754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACAGCGCTGCCCTCATGGAGTTACAGGGACACATCGGCAGATTCCAG[G/A]TGAAATATTGAAACAAATATTTCAAAATGCTATTATATAGAGCAGAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216 Essential Splice Site 1868 1972 39 41
ENSDART00000062360 Essential Splice Site 1865 1996 39 40
ENSDART00000125555 Essential Splice Site 1870 2001 39 40
ENSDART00000143923 Essential Splice Site 1873 1977 39 41
Genomic Location (Zv9):
Chromosome 18 (position 11686712)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12269441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACCTGGAAATGGGGAAATGTGTTGTTCTTGACGTGTTTTTTCTGAA[G/A]ATATCATTGAGACGTGTCTGTTTGTCATCTGGCGCCACCTAGAGTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062216   None 1972 None 41
ENSDART00000062360 Nonsense 1907 1996 39 40
ENSDART00000125555 Nonsense 1912 2001 39 40
ENSDART00000143923   None 1977 None 41
Genomic Location (Zv9):
Chromosome 18 (position 11686586)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12269315
KASP Assay ID:
554-3821.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYAAAGACTCACTGCTGCCAGGTTACAGAGGTCAGCTTTCTCTYAAGCTT[C/T]AGGATTATTTTCARATGCTGTTGAATGACATGGTTTCTTACCAGATTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Paget's disease: Genome-wide association identifies three new susceptibility loci for Paget's disease of bone. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link