og9x

Ensembl ID:
ENSDARG00000042526
ZFIN ID:
ZDB-GENE-021206-4
Description:
Homeobox protein SEBOX [Source:UniProtKB/Swiss-Prot;Acc:Q8JJ26]
Human Orthologue:
VTN
Human Description:
vitronectin [Source:HGNC Symbol;Acc:12724]
Mouse Orthologue:
Sebox
Mouse Description:
SEBOX homeobox Gene [Source:MGI Symbol;Acc:MGI:108012]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33769 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062357 Essential Splice Site 35 293 1 5
ENSDART00000142156 Essential Splice Site 55 313 1 4
Genomic Location (Zv9):
Chromosome 5 (position 70368324)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66693468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACAGAAAGTGATTTTATTTTCAACACAAATATGCTTCAGTTTACAG[G/A]TAAGTTTGCATTTAATTCTGTCACGACAACAAATGCTTTTATGTTTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link