coe2

Ensembl ID:
ENSDARG00000042525
ZFIN ID:
ZDB-GENE-990715-11
Description:
Transcription factor COE2 [Source:UniProtKB/Swiss-Prot;Acc:O93375]
Human Orthologue:
EBF2
Human Description:
early B-cell factor 2 [Source:HGNC Symbol;Acc:19090]
Mouse Orthologue:
Ebf2
Mouse Description:
early B-cell factor 2 Gene [Source:MGI Symbol;Acc:MGI:894332]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2249 Essential Splice Site F2 line generated During 2017
sa20582 Essential Splice Site Available for shipment Available now
sa44626 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2249
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014822 Essential Splice Site 136 578 5 16
Genomic Location (Zv9):
Chromosome 5 (position 70394648)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66719792
KASP Assay ID:
554-3310.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTTCTGATTTTTAATGCATYGATTCGCATTGCTGTTTTGCATGGTTCA[G/A]CCCATATCATATGAAGGGCAGAACAAGAATCCAGAAATGTGCCGCGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014822 Essential Splice Site 302 578 10 16
Genomic Location (Zv9):
Chromosome 5 (position 70428500)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66753644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGTGTAACAAACTTTAACAACTTGTTTTTCTCTCATTATTCGTGCA[G/A]TTGATCACACCTCATGCGATTCGAGTTCAGACTCCACCTCGACACATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014822 Nonsense 352 578 11 16
Genomic Location (Zv9):
Chromosome 5 (position 70429527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCATTTGATTTGGTTTTCTCTAGCACTGAATGAGCCTACTATTGACTA[C/A]GGCTTCCAGAGGCTCCAAAAGCTCATCCCTCGACATCCCGGTGACCCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link