
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
coe2
- Ensembl ID:
- ENSDARG00000042525
- ZFIN ID:
- ZDB-GENE-990715-11
- Description:
- Transcription factor COE2 [Source:UniProtKB/Swiss-Prot;Acc:O93375]
- Human Orthologue:
- EBF2
- Human Description:
- early B-cell factor 2 [Source:HGNC Symbol;Acc:19090]
- Mouse Orthologue:
- Ebf2
- Mouse Description:
- early B-cell factor 2 Gene [Source:MGI Symbol;Acc:MGI:894332]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2249 | Essential Splice Site | F2 line generated | During 2018 |
sa20582 | Essential Splice Site | Available for shipment | Available now |
sa44626 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2249
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014822 | Essential Splice Site | 136 | 578 | 5 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70394648)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66719792 GRCz11 5 67398161 - KASP Assay ID:
- 554-3310.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGTTCTGATTTTTAATGCATYGATTCGCATTGCTGTTTTGCATGGTTCA[G/A]CCCATATCATATGAAGGGCAGAACAAGAATCCAGAAATGTGCCGCGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20582
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014822 | Essential Splice Site | 302 | 578 | 10 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70428500)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66753644 GRCz11 5 67432013 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATTGTGTAACAAACTTTAACAACTTGTTTTTCTCTCATTATTCGTGCA[G/A]TTGATCACACCTCATGCGATTCGAGTTCAGACTCCACCTCGACACATTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44626
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014822 | Nonsense | 352 | 578 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70429527)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66754671 GRCz11 5 67433040 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCATTTGATTTGGTTTTCTCTAGCACTGAATGAGCCTACTATTGACTA[C/A]GGCTTCCAGAGGCTCCAAAAGCTCATCCCTCGACATCCCGGTGACCCCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: