coe2

Ensembl ID:
ENSDARG00000042525
ZFIN ID:
ZDB-GENE-990715-11
Description:
Transcription factor COE2 [Source:UniProtKB/Swiss-Prot;Acc:O93375]
Human Orthologue:
EBF2
Human Description:
early B-cell factor 2 [Source:HGNC Symbol;Acc:19090]
Mouse Orthologue:
Ebf2
Mouse Description:
early B-cell factor 2 Gene [Source:MGI Symbol;Acc:MGI:894332]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2249 Essential Splice Site F2 line generated During 2014
sa20582 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2249
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014822 Essential Splice Site 136 578 5 16
Genomic Location:
Chromosome 5 (position 70394648)
KASP Assay ID:
554-3310.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTTCTGATTTTTAATGCATYGATTCGCATTGCTGTTTTGCATGGTTCA[G/A]CCCATATCATATGAAGGGCAGAACAAGAATCCAGAAATGTGCCGCGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014822 Essential Splice Site 302 578 10 16
Genomic Location:
Chromosome 5 (position 70428500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGTGTAACAAACTTTAACAACTTGTTTTTCTCTCATTATTCGTGCA[G/A]TTGATCACACCTCATGCGATTCGAGTTCAGACTCCACCTCGACACATTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k62ubhga