hipk2

Ensembl ID:
ENSDARG00000042518
ZFIN ID:
ZDB-GENE-031125-4
Description:
homeodomain-interacting protein kinase 2 isoform 2 [Source:RefSeq peptide;Acc:NP_001093455]
Human Orthologue:
HIPK2
Human Description:
homeodomain interacting protein kinase 2 [Source:HGNC Symbol;Acc:14402]
Mouse Orthologue:
Hipk2
Mouse Description:
homeodomain interacting protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1314872]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23245 Nonsense Available for shipment Available now
sa36590 Nonsense Available for shipment Available now
sa39193 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23244 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062343 Nonsense 81 1228 2 15
ENSDART00000090335 Nonsense 74 1220 1 14
Genomic Location (Zv9):
Chromosome 18 (position 12061033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12643762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCATCAACGGCGCCAGTCTCCAGGTTTCCAACTCTTCCCTGTCATAC[G/T]AACAGGCCCTACTCTTCCCGGCCGGCTCGGGGCACATTGTTGTGGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062343 Nonsense 279 1228 2 15
ENSDART00000090335 Nonsense 272 1220 1 14
Genomic Location (Zv9):
Chromosome 18 (position 12060437)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12643166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAGGTGAGCATACTGGCACGGCTGAGCACGGAGAGTGCGGACGACTA[C/A]AACTTTGTTCGAGCGTACGAGTGCTTCCAGCACAAGAACCACACGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062343 Essential Splice Site 430 1228 3 15
ENSDART00000090335 Essential Splice Site 423 1220 2 14
Genomic Location (Zv9):
Chromosome 18 (position 11967240)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12549969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTTTTGGGATGGCCTCTTTATCCCGGAGCATCAGAGTATGACCAG[G/A]TAACACACTCAGCTACTTCTTTAATGCATTATAATAAAGGCGCAAGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062343 Nonsense 768 1228 10 15
ENSDART00000090335 Nonsense 761 1220 9 14
Genomic Location (Zv9):
Chromosome 18 (position 11924339)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12507068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTCAGTGCAACACGCCACCGTCATCCCAGACTCCATGACCAGCTCA[C/T]AGCCTCTGGCTAACTGGAGGTGAGACAGCACTACATCAATTTGACTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link