gpr176

Ensembl ID:
ENSDARG00000042515
ZFIN ID:
ZDB-GENE-041001-183
Description:
probable G-protein coupled receptor 176 [Source:RefSeq peptide;Acc:NP_001122183]
Human Orthologue:
GPR176
Human Description:
G protein-coupled receptor 176 [Source:HGNC Symbol;Acc:32370]
Mouse Orthologue:
Gpr176
Mouse Description:
G protein-coupled receptor 176 Gene [Source:MGI Symbol;Acc:MGI:2685858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37057 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062347 Nonsense 87 544 2 3
ENSDART00000147917 Nonsense 69 524 2 3
Genomic Location (Zv9):
Chromosome 20 (position 28995715)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29066928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTTTTGTCTCCAGGCAATACTGCAGTGCTGTGGTGCACGATCTA[C/A]ACAAATGTCTTCAAGTCCGTCACAAATCTCTTCATCAAGAATCTGGCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link