si:dkey-11e23.3

Ensembl ID:
ENSDARG00000042513
ZFIN ID:
ZDB-GENE-041001-181
Description:
Novel transcript similar to vertebrate peroxisomal long-chain acyl-coA thioesterase [Source:UniProtK
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
Mouse Orthologues:
Acot1, Acot2, Acot3, Acot4, Acot5, Acot6
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25139 Nonsense Mutation detected in F1 DNA During 2017
sa29377 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37056 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062342 Nonsense 49 437 1 3
Genomic Location (Zv9):
Chromosome 20 (position 28982056)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29053269
KASP Assay ID:
554-7316.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTATAAGTGCTCTTTTGAAGACCCAGTGCATGTGACGGTGAGCGGCT[T/G]AAATCCACATCAACGCGTGGACCTGCGCTCCAAAATCACGGATGAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062342 Essential Splice Site 238 437 2 3
Genomic Location (Zv9):
Chromosome 20 (position 28973363)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29044576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGAGTACTTTGAAGAAGGTATAGATTTCCTACGGCAACAGCCAGAGG[T/C]TAGTACAACCATTTATTATCTTTAGTTGTTGTTTTTATAGCAAAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062342 Nonsense 384 437 3 3
Genomic Location (Zv9):
Chromosome 20 (position 28972811)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29044024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAGCTGGTAAAGTATGAAAAGGCGGGTCATTTTATTGAGGTGCCCTA[T/A]ATGCCCTTTTGCTTTGCTAATTTTCATAGTGTACTTAAGCAACCTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link