si:dkey-11e23.4

Ensembl ID:
ENSDARG00000042510
ZFIN ID:
ZDB-GENE-041001-182
Description:
Novel protein similar to vertebrate acyl-CoA thioesterase family [Source:UniProtKB/TrEMBL;Acc:Q5SPG8
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
Mouse Orthologues:
Acot1, Acot2, Acot3, Acot4, Acot5, Acot6
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14100 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062338 Nonsense 34 439 1 3
Genomic Location (Zv9):
Chromosome 20 (position 28961429)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29032642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAAATGCACTACAGTTCAGRAGTCAGCATCAGGCTTCTGCCCAGTTA[T/A]AAGTGCTCTTTTGAAGACCCAGTGCATGTGACGGTGAGCGGCTTAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link