glod4

Ensembl ID:
ENSDARG00000042509
ZFIN ID:
ZDB-GENE-040912-38
Description:
glyoxalase domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001004613]
Human Orthologue:
GLOD4
Human Description:
glyoxalase domain containing 4 [Source:HGNC Symbol;Acc:14111]
Mouse Orthologue:
Glod4
Mouse Description:
glyoxalase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1914451]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22606 Nonsense Mutation detected in F1 DNA During 2016
sa15824 Nonsense Available for shipment Available now
sa35836 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062335 Nonsense 132 298 4 9
Genomic Location:
Chromosome 15 (position 15200925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGACTGAGGCTCCAGGTGGATACCGCTTCTACCTCATAGACAAGGAA[C/T]AGCCAAACTCTGGTGGGTATTTGCCGAAAAAAATGTGTTACACTTGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062335 Nonsense 181 298 5 9
Genomic Location:
Chromosome 15 (position 15200597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAAAAATGAGGWCAAAAAGAKTGCAGTAATGGGATTCTCAGATAAT[C/T]AGGTTTGGCTGAAAATAATACATTTATTATATTTTTGGCGATAATTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062335 Nonsense 273 298 8 9
Genomic Location:
Chromosome 15 (position 15198196)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGACGAGGCCTTCAGGCAGCTTTCTGCAGTGGATCCTAATGGGAAT[C/T]AATTACTAGATGAGGTAATCAGTATCTATTTTTTATCACACAGTAAACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link