glod4

Ensembl ID:
ENSDARG00000042509
ZFIN ID:
ZDB-GENE-040912-38
Description:
glyoxalase domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001004613]
Human Orthologue:
GLOD4
Human Description:
glyoxalase domain containing 4 [Source:HGNC Symbol;Acc:14111]
Mouse Orthologue:
Glod4
Mouse Description:
glyoxalase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1914451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22606 Nonsense Mutation detected in F1 DNA During 2014
sa15824 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062335 Nonsense 132 298 4 9
Genomic Location:
Chromosome 15 (position 15200925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGACTGAGGCTCCAGGTGGATACCGCTTCTACCTCATAGACAAGGAA[C/T]AGCCAAACTCTGGTGGGTATTTGCCGAAAAAAATGTGTTACACTTGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062335 Nonsense 181 298 5 9
Genomic Location:
Chromosome 15 (position 15200597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAAAAATGAGGWCAAAAAGAKTGCAGTAATGGGATTCTCAGATAAT[C/T]AGGTTTGGCTGAAAATAATACATTTATTATATTTTTGGCGATAATTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8s0tnl1f