ubr3

Ensembl ID:
ENSDARG00000042508
ZFIN ID:
ZDB-GENE-030131-1473
Description:
Ubr3 protein [Source:UniProtKB/TrEMBL;Acc:Q1JPS8]
Human Orthologue:
UBR3
Human Description:
ubiquitin protein ligase E3 component n-recognin 3 (putative) [Source:HGNC Symbol;Acc:30467]
Mouse Orthologue:
Ubr3
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 3 Gene [Source:MGI Symbol;Acc:MGI:1861100]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17047 Nonsense Available for shipment Available now
sa16003 Nonsense Available for shipment Available now
sa34547 Nonsense Mutation detected in F1 DNA During 2016
sa10176 Essential Splice Site Available for shipment Available now
sa2488 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa17047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047723 Nonsense 196 288 5 6
ENSDART00000062336 Nonsense 97 607 3 14
ENSDART00000129091 Nonsense 444 954 8 20
ENSDART00000129693 Nonsense 97 607 3 15

The following transcripts of ENSDARG00000042508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 3944302)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3960681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCGCTTTGCCGCCAGTTTGCAAACAGTGTTTTACCTTGTCGTCCTGGA[C/T]GAGGGATGGAAACCGGAGCCTGGCAYGCACCCAGTACCAAGAGCATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047723   None 288 None 6
ENSDART00000062336 Nonsense 224 607 6 14
ENSDART00000129091 Nonsense 571 954 11 20
ENSDART00000129693 Nonsense 224 607 6 15

The following transcripts of ENSDARG00000042508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 3933145)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3949524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCACGTGCTGGCCATGCACATGCGGCTCTACAGCATAGACTCGGCATA[C/A]AATCCATGGACCAGACTCACACTGAGCACGCAAAGCAGAGAGAATGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047723   None 288 None 6
ENSDART00000062336 Nonsense 238 607 6 14
ENSDART00000129091 Nonsense 585 954 11 20
ENSDART00000129693 Nonsense 238 607 6 15

The following transcripts of ENSDARG00000042508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 3933105)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3949484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGGCATACAATCCATGGACCAGACTCACACTGAGCACGCAAAGCAGA[G/T]AGAATGAGTGAGTGCGCTCGCGCACACACACACACACACACCCACACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047723   None 288 None 6
ENSDART00000062336 Essential Splice Site 274 607 7 14
ENSDART00000129091 Essential Splice Site 621 954 12 20
ENSDART00000129693 Essential Splice Site 274 607 7 15

The following transcripts of ENSDARG00000042508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 3928048)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3944427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTCCTAATCATCTTCATCCTCACCATGCCTCAGCCTTTACGCAAAGG[T/C]ACACACACACTMACTCAMAGAGAGAAAATATTCAAACTTTAATTTTACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2488
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047723   None 288 None 6
ENSDART00000062336 Nonsense 422 607 11 14
ENSDART00000129091 Nonsense 769 954 16 20
ENSDART00000129693 Nonsense 422 607 11 15

The following transcripts of ENSDARG00000042508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 3918079)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3934458
KASP Assay ID:
554-2681.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTAGCTGCTTCTGTTCAGKGCAGTGGATCCATGAGCAGCGCAGCGTG[T/A]CTGGAGTGGAACATCRGTGCTTTTGACTTGATCAGTCAGTGGTGCTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link