polm

Ensembl ID:
ENSDARG00000042507
ZFIN IDs:
ZDB-GENE-030813-1, ZDB-GENE-040426-911
Description:
DNA polymerase mu [Source:RefSeq peptide;Acc:NP_956542]
Human Orthologue:
POLM
Human Description:
polymerase (DNA directed), mu [Source:HGNC Symbol;Acc:9185]
Mouse Orthologue:
Polm
Mouse Description:
polymerase (DNA directed), mu Gene [Source:MGI Symbol;Acc:MGI:1860191]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7341 Missense, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062331 Missense, Splice Site 452 507 10 11
ENSDART00000063570 Missense, Splice Site 452 745 10 13
Genomic Location (Zv9):
Chromosome 10 (position 46339716)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45171360
KASP Assay ID:
554-4312.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGTGGTTGCAGCTGTTCTGAGGTCAGTGTTCTGTGTGTTCTGCAGC[T/C]GTTTGAGCGGGAGTTGAGGAGGTGGGCGGGGCAAGAGAAGCAGATGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link