h2afvl

Ensembl ID:
ENSDARG00000042502
ZFIN ID:
ZDB-GENE-050506-24
Description:
histone 2A family member ZA [Source:RefSeq peptide;Acc:NP_001036788]
Human Orthologue:
H2AFZ
Human Description:
H2A histone family, member Z [Source:HGNC Symbol;Acc:4741]
Mouse Orthologue:
H2afz
Mouse Description:
H2A histone family, member Z Gene [Source:MGI Symbol;Acc:MGI:1888388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21818 Nonsense Available for shipment Available now
sa18996 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062324 Nonsense 48 149 2 5
Genomic Location (Zv9):
Chromosome 10 (position 46371191)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45139885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAAAGCCAAGACGAAAGCCGTCTCCAGATCTCAGAGAGCTGGTCTG[C/T]AGGTACTGACTCCAACAAAACATACATGCATAGTATAAATAGAAAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062324 Nonsense 86 149 3 5
Genomic Location (Zv9):
Chromosome 10 (position 46368210)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45142866
KASP Assay ID:
2260-3718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTACAGCTGCGGTTTACAGTGCTGCTATCCTGGAGTATCTCACCGCT[G/T]AGGTAACATCAGGGTTTATTTAATGAATTAATTTTTACCTAGAGTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link