parp12a

Ensembl ID:
ENSDARG00000042496
ZFIN ID:
ZDB-GENE-050419-6
Description:
Novel protein similar to vertebrate zinc finger CCCH type domain containing 1 (ZC3HDC1) [Source:UniP
Human Orthologue:
PARP12
Human Description:
poly (ADP-ribose) polymerase family, member 12 [Source:HGNC Symbol;Acc:21919]
Mouse Orthologues:
Parp12, Zc3hav1
Mouse Descriptions:
poly (ADP-ribose) polymerase family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2143990]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28994 Nonsense Mutation detected in F1 DNA During 2017
sa43063 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130343 Nonsense 431 663 8 12
Genomic Location (Zv9):
Chromosome 18 (position 12292752)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12875481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAAGTTTGACATTCATTTTCAGAGATGTGCCAACAAAATCTGAAGTA[C/A]AAAACTGAGAGAGATGTTCGAAGGAGACCTCGTTTTGTATCTGCTCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130343 Essential Splice Site 485 663 10 12
Genomic Location (Zv9):
Chromosome 18 (position 12291567)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12874296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTAAAATACTGATGACATTTCACTAATCAAATTTAATATCTCCTC[A/T]GATTGTTTCACTGCAAAAAACTTGCAAGGAGTATGAGAGAGTGAGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130343 Nonsense 655 663 12 12
Genomic Location (Zv9):
Chromosome 18 (position 12288036)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12870765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGAGGCAAACCCGGCCATTTTTGTCGTGTTTGAGAAATTTCAGATCTA[T/A]CCGGAGTACATCATTGAATACTCCTGATATGTGCCGTGTCAAATTATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link