prkrir

Ensembl ID:
ENSDARG00000042489
ZFIN ID:
ZDB-GENE-040426-2045
Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18987 Nonsense Mutation detected in F1 DNA During 2017
sa41687 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062309 Nonsense 246 748 5 5
Genomic Location (Zv9):
Chromosome 10 (position 33017424)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32118773
KASP Assay ID:
2260-3405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTGCATTCGTGAAGAGCTGTTGGCTGAAGCTAAAGAAGGACGCTG[C/A]TTCTCTTTAGTTGTAGATAACCTGGTTGAGATAGAAGGAGAAAACTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062309 Nonsense 417 748 5 5
Genomic Location (Zv9):
Chromosome 10 (position 33017935)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32119284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAGGCTAATGTCCTTAAGGAGGCGTGCGGCTCTAAATGGACAGAG[C/T]AACACGATACCTTTGAATTGGCGGTTGACCTCTTGGAGTCTCTCCTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link