foxd5

Ensembl ID:
ENSDARG00000042485
ZFIN ID:
ZDB-GENE-980605-4
Description:
forkhead box D5 [Source:RefSeq peptide;Acc:NP_571345]
Human Orthologues:
FOXD4, FOXD4L1, FOXD4L2, FOXD4L3, FOXD4L4, FOXD4L5, FOXD4L6
Human Descriptions:
forkhead box D4 [Source:HGNC Symbol;Acc:3805]
forkhead box D4-like 1 [Source:HGNC Symbol;Acc:18521]
forkhead box D4-like 2 [Source:HGNC Symbol;Acc:24813]
forkhead box D4-like 3 [Source:HGNC Symbol;Acc:18523]
forkhead box D4-like 4 [Source:HGNC Symbol;Acc:23762]
forkhead box D4-like 5 [Source:HGNC Symbol;Acc:18522]
forkhead box D4-like 6 [Source:HGNC Symbol;Acc:31986]
Mouse Orthologue:
Foxd4
Mouse Description:
forkhead box D4 Gene [Source:MGI Symbol;Acc:MGI:1347467]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3657 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062303 Nonsense 168 321 1 1
Genomic Location:
Chromosome 8 (position 31301501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATCTGAGGACATGTTTGACAATGGCAGCTTTCTGCGCAGAAGAAAA[C/T]GATTCAAGAGGAACCAGCCCGAGTTCACCAAAGACAGCCTGGTGCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8wt8lg13